Review



sequence scramble online tool  (GenScript corporation)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    GenScript corporation sequence scramble online tool
    Sequence Scramble Online Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence scramble online tool/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    sequence scramble online tool - by Bioz Stars, 2026-04
    90/100 stars

    Images



    Similar Products

    scrambled sequence sc-37007  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology scrambled sequence sc-37007
    Scrambled Sequence Sc 37007, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled sequence sc-37007/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    scrambled sequence sc-37007 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    sequence scramble online tool  (GenScript corporation)
    90
    GenScript corporation sequence scramble online tool
    Sequence Scramble Online Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence scramble online tool/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    sequence scramble online tool - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    scrambled sequence control sirna-a  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology scrambled sequence control sirna-a
    Scrambled Sequence Control Sirna A, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled sequence control sirna-a/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    scrambled sequence control sirna-a - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    scrambled shrna sequence tagged with gfp shnc  (Genechem)
    90
    Genechem scrambled shrna sequence tagged with gfp shnc
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Scrambled Shrna Sequence Tagged With Gfp Shnc, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled shrna sequence tagged with gfp shnc/product/Genechem
    Average 90 stars, based on 1 article reviews
    scrambled shrna sequence tagged with gfp shnc - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    scrambled nc sequence  (Shanghai GenePharma)
    90
    Shanghai GenePharma scrambled nc sequence
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Scrambled Nc Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled nc sequence/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    scrambled nc sequence - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    control sirna containing a scrambled sequence si-nc  (Ribobio co)
    90
    Ribobio co control sirna containing a scrambled sequence si-nc
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Control Sirna Containing A Scrambled Sequence Si Nc, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control sirna containing a scrambled sequence si-nc/product/Ribobio co
    Average 90 stars, based on 1 article reviews
    control sirna containing a scrambled sequence si-nc - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    adenoviral vectors expressing a control scrambled sequence  (Shanghai GenePharma)
    90
    Shanghai GenePharma adenoviral vectors expressing a control scrambled sequence
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Adenoviral Vectors Expressing A Control Scrambled Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/adenoviral vectors expressing a control scrambled sequence/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    adenoviral vectors expressing a control scrambled sequence - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    aβ42 scrambled sequence (aβ42s)  (Bachem)
    90
    Bachem aβ42 scrambled sequence (aβ42s)
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Aβ42 Scrambled Sequence (Aβ42s), supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aβ42 scrambled sequence (aβ42s)/product/Bachem
    Average 90 stars, based on 1 article reviews
    aβ42 scrambled sequence (aβ42s) - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    aβ40 scrambled sequence (aβ40s)  (AnaSpec)
    90
    AnaSpec aβ40 scrambled sequence (aβ40s)
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Aβ40 Scrambled Sequence (Aβ40s), supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aβ40 scrambled sequence (aβ40s)/product/AnaSpec
    Average 90 stars, based on 1 article reviews
    aβ40 scrambled sequence (aβ40s) - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    non targeting sequence  (Addgene inc)
    96
    Addgene inc non targeting sequence
    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines <t>shNC,</t> <t>shPROX1‐3,</t> and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. <t>GFP</t> indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.
    Non Targeting Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting sequence/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    non targeting sequence - by Bioz Stars, 2026-04
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines shNC, shPROX1‐3, and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. GFP indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.

    Journal: The FASEB Journal

    Article Title: MS 275 Inhibits Neuroblastoma Cell Growth by Mediating H 3 K 27ac/ PROX 1 Axis In Silico and In Vitro

    doi: 10.1096/fj.202500464RR

    Figure Lengend Snippet: PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines shNC, shPROX1‐3, and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. GFP indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.

    Article Snippet: For the lentivirus‐mediated RNA interference targeting PROX1expression, three specific short hairpin RNAs (shRNAs) against PROX1, namely, shPROX1‐3 (target sequence: GCTCTGAACATGCACTACAAT), shPROX1‐4 (target sequence: CCGACGTAAAGTTCAACAGAT), and shPROX1‐5 (target sequence: CCCGAGAAAGTTACAGAGAAA) along with a scrambled shRNA sequence tagged with GFP, serving as a negative control (shNC), were purchased from Genechem (Shanghai, China).

    Techniques: Stable Transfection, Cell Culture, Flow Cytometry, Staining